a 889 Search Results


94
ATCC b78 wa1 b204 2818 1 pws a 889 b2s6
B78 Wa1 B204 2818 1 Pws A 889 B2s6, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/a+889/pm07557328-25-8-20?v=ATCC
Average 94 stars, based on 1 article reviews
b78 wa1 b204 2818 1 pws a 889 b2s6 - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

99
Thermo Fisher fluorescein oregon green polyclonal antibody
Fluorescein Oregon Green Polyclonal Antibody, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/a+889/pm36072569-105-26-30?v=Thermo+Fisher
Average 99 stars, based on 1 article reviews
fluorescein oregon green polyclonal antibody - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

96
ATCC species
Species, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/a+889/pmc09309852-21-26-29?v=ATCC
Average 96 stars, based on 1 article reviews
species - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

90
Metrohm AG 889 ic sample center
889 Ic Sample Center, supplied by Metrohm AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/a+889/10__1016_slash_j__focha__2024__100722-65-13-14?v=Metrohm+AG
Average 90 stars, based on 1 article reviews
889 ic sample center - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Hamamatsu uv-vis spectrometer c12880
Uv Vis Spectrometer C12880, supplied by Hamamatsu, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/a+889/10__1016_slash_j__foodcont__2020__107744-76-9-19?v=Hamamatsu
Average 90 stars, based on 1 article reviews
uv-vis spectrometer c12880 - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

91
Addgene inc alpha yap
Figure 4. Treatment with choline kinase <t>alpha</t> inhibitors results in mis-localization of PI(4,5)P2 and decreases vinculin localization in focal adhesions in control U2OS cells but has no effect on U2OS cells overexpressing Myc-CHKB. (A) U2OS cells were transiently transfected with the PI(4,5)P2 <t>reporter</t> <t>PH-PLCD1-GFP</t> and were treated with the choline kinase alpha inhibitors EB-3D (10 mM), CK-37 (15 mM) or vehicle for 48 h and live cells were imaged by spinning-disk confocal microscopy. Choline kinase alpha inhibition resulted in the loss of dorsal membrane PH- PLCD1-GFP clusters in the U2OS cells. (B) The ratio of dorsal plasma membrane: cytoplasmic PH-PLCD1-GFP fluorescence is significantly decreased in choline kinase
Alpha Yap, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/a+889/pm38749543-143-9-13?v=Addgene+inc
Average 91 stars, based on 1 article reviews
alpha yap - by Bioz Stars, 2026-08
91/100 stars
  Buy from Supplier

95
Cytiva Europe syringe
Figure 4. Treatment with choline kinase <t>alpha</t> inhibitors results in mis-localization of PI(4,5)P2 and decreases vinculin localization in focal adhesions in control U2OS cells but has no effect on U2OS cells overexpressing Myc-CHKB. (A) U2OS cells were transiently transfected with the PI(4,5)P2 <t>reporter</t> <t>PH-PLCD1-GFP</t> and were treated with the choline kinase alpha inhibitors EB-3D (10 mM), CK-37 (15 mM) or vehicle for 48 h and live cells were imaged by spinning-disk confocal microscopy. Choline kinase alpha inhibition resulted in the loss of dorsal membrane PH- PLCD1-GFP clusters in the U2OS cells. (B) The ratio of dorsal plasma membrane: cytoplasmic PH-PLCD1-GFP fluorescence is significantly decreased in choline kinase
Syringe, supplied by Cytiva Europe, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/a+889/pmc06162559-125-46-47?v=Cytiva+Europe
Average 95 stars, based on 1 article reviews
syringe - by Bioz Stars, 2026-08
95/100 stars
  Buy from Supplier

86
Routledge Ltd 889 feisal khan
Figure 4. Treatment with choline kinase <t>alpha</t> inhibitors results in mis-localization of PI(4,5)P2 and decreases vinculin localization in focal adhesions in control U2OS cells but has no effect on U2OS cells overexpressing Myc-CHKB. (A) U2OS cells were transiently transfected with the PI(4,5)P2 <t>reporter</t> <t>PH-PLCD1-GFP</t> and were treated with the choline kinase alpha inhibitors EB-3D (10 mM), CK-37 (15 mM) or vehicle for 48 h and live cells were imaged by spinning-disk confocal microscopy. Choline kinase alpha inhibition resulted in the loss of dorsal membrane PH- PLCD1-GFP clusters in the U2OS cells. (B) The ratio of dorsal plasma membrane: cytoplasmic PH-PLCD1-GFP fluorescence is significantly decreased in choline kinase
889 Feisal Khan, supplied by Routledge Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/a+889/o_sullivan_michael__2019__before_islamic_finance_the_political_and_religious_economies_of_indian_muslim_capital_from_the_balkans-3626-24-42?v=Routledge+Ltd
Average 86 stars, based on 1 article reviews
889 feisal khan - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

93
ADInstruments rat pv catheter
Figure 4. Treatment with choline kinase <t>alpha</t> inhibitors results in mis-localization of PI(4,5)P2 and decreases vinculin localization in focal adhesions in control U2OS cells but has no effect on U2OS cells overexpressing Myc-CHKB. (A) U2OS cells were transiently transfected with the PI(4,5)P2 <t>reporter</t> <t>PH-PLCD1-GFP</t> and were treated with the choline kinase alpha inhibitors EB-3D (10 mM), CK-37 (15 mM) or vehicle for 48 h and live cells were imaged by spinning-disk confocal microscopy. Choline kinase alpha inhibition resulted in the loss of dorsal membrane PH- PLCD1-GFP clusters in the U2OS cells. (B) The ratio of dorsal plasma membrane: cytoplasmic PH-PLCD1-GFP fluorescence is significantly decreased in choline kinase
Rat Pv Catheter, supplied by ADInstruments, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/a+889/pm32710530-59-17-21?v=ADInstruments
Average 93 stars, based on 1 article reviews
rat pv catheter - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

90
Metrohm AG sample changer metrohm 889 ic sample center
Figure 4. Treatment with choline kinase <t>alpha</t> inhibitors results in mis-localization of PI(4,5)P2 and decreases vinculin localization in focal adhesions in control U2OS cells but has no effect on U2OS cells overexpressing Myc-CHKB. (A) U2OS cells were transiently transfected with the PI(4,5)P2 <t>reporter</t> <t>PH-PLCD1-GFP</t> and were treated with the choline kinase alpha inhibitors EB-3D (10 mM), CK-37 (15 mM) or vehicle for 48 h and live cells were imaged by spinning-disk confocal microscopy. Choline kinase alpha inhibition resulted in the loss of dorsal membrane PH- PLCD1-GFP clusters in the U2OS cells. (B) The ratio of dorsal plasma membrane: cytoplasmic PH-PLCD1-GFP fluorescence is significantly decreased in choline kinase
Sample Changer Metrohm 889 Ic Sample Center, supplied by Metrohm AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/a+889/pmc05453271-222-2-3?v=Metrohm+AG
Average 90 stars, based on 1 article reviews
sample changer metrohm 889 ic sample center - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Bio-Rad lys 240 p agcggggtgcgcgcg 890 b cgataagaccggagctagc a 870 p gctagctccggtcttatcggc 868 u cgcgcaccccgct t
Figure 4. Treatment with choline kinase <t>alpha</t> inhibitors results in mis-localization of PI(4,5)P2 and decreases vinculin localization in focal adhesions in control U2OS cells but has no effect on U2OS cells overexpressing Myc-CHKB. (A) U2OS cells were transiently transfected with the PI(4,5)P2 <t>reporter</t> <t>PH-PLCD1-GFP</t> and were treated with the choline kinase alpha inhibitors EB-3D (10 mM), CK-37 (15 mM) or vehicle for 48 h and live cells were imaged by spinning-disk confocal microscopy. Choline kinase alpha inhibition resulted in the loss of dorsal membrane PH- PLCD1-GFP clusters in the U2OS cells. (B) The ratio of dorsal plasma membrane: cytoplasmic PH-PLCD1-GFP fluorescence is significantly decreased in choline kinase
Lys 240 P Agcggggtgcgcgcg 890 B Cgataagaccggagctagc A 870 P Gctagctccggtcttatcggc 868 U Cgcgcaccccgct T, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/a+889/pmc00089975-137-81-14?v=Bio-Rad
Average 90 stars, based on 1 article reviews
lys 240 p agcggggtgcgcgcg 890 b cgataagaccggagctagc a 870 p gctagctccggtcttatcggc 868 u cgcgcaccccgct t - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Ribobio co biotin-labeled mir-899-3p mimic bio-mir-889-3p
hsa_circ_0009035 in CC cells directly targeted miR-889-3p by binding to miR-889-3p. (A) Venn diagram of the putative miRNAs of hsa_circ_0009035 predicted by Circinteractome and Starbase softwares. (B and C) The expression levels of miR-1296, miR-182, miR-653, and miR-889-3p by qRT-PCR in sh-NC-infected or sh-hsa_circ_0009035-transduced HeLa and Siha cells. (D) RNA pulldown assays in HeLa cells using Bio-anti-hsa_circ_0009035 or Bio-NC. (E) Sequence of miR-889-3p and the putative miR-889-3p-binding sequence within hsa_circ_0009035. (F and G) Relative miR-889-3p expression determined by qRT-PCR in HeLa and Siha cells transfected with negative-control plasmid pCD5-ciR, an hsa_circ_0009035-overexpressing plasmid (hsa_circ_0009035), or a mutant hsa_circ_0009035-overexpressing plasmid (MUT-hsa_circ_0009035). (H) RIP assay in HeLa and Siha cells using IgG or AGO2 antibody. (I) RNA pulldown assays in HeLa cells using Bio-NC or Bio-miR-889-3p. (J and K) qRT-PCR analysis of hsa_circ_0009035 expression in cells transfected with miR-NC mimic, miR-889-3p mimic, anti-miR-889-3p, or anti-miR-NC. (L) The level of <t>pre-miR-899</t> by qRT-PCR in cells transduced with sh-NC, sh-hsa_circ_0009035, or sh-hsa_circ_0009035#2. Relative miR-889-3p expression by qRT-PCR in 82 pairs of CC tissues and adjacent normal tissues (M) and CC tissues from 36 primary patients (defined as radiation-sensitive CC) and 46 recurrent patients after radiation treatment (defined as radiation-resistant CC) (N). (O) Correlation between miR-889-3p and hsa_circ_0009035 expression levels in CC tissues using the Spearman test. (P and Q) Copy numbers of hsa_circ_0009035 and miR-889-3p in HeLa and Siha cells and 5 case CC tissues. * , P < 0.05.
Biotin Labeled Mir 899 3p Mimic Bio Mir 889 3p, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/a+889/pmc08316008-193-11-14?v=Ribobio+co
Average 90 stars, based on 1 article reviews
biotin-labeled mir-899-3p mimic bio-mir-889-3p - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

Image Search Results


Figure 4. Treatment with choline kinase alpha inhibitors results in mis-localization of PI(4,5)P2 and decreases vinculin localization in focal adhesions in control U2OS cells but has no effect on U2OS cells overexpressing Myc-CHKB. (A) U2OS cells were transiently transfected with the PI(4,5)P2 reporter PH-PLCD1-GFP and were treated with the choline kinase alpha inhibitors EB-3D (10 mM), CK-37 (15 mM) or vehicle for 48 h and live cells were imaged by spinning-disk confocal microscopy. Choline kinase alpha inhibition resulted in the loss of dorsal membrane PH- PLCD1-GFP clusters in the U2OS cells. (B) The ratio of dorsal plasma membrane: cytoplasmic PH-PLCD1-GFP fluorescence is significantly decreased in choline kinase

Journal: Life science alliance

Article Title: Defects in integrin complex formation promote CHKB -mediated muscular dystrophy.

doi: 10.26508/lsa.202301956

Figure Lengend Snippet: Figure 4. Treatment with choline kinase alpha inhibitors results in mis-localization of PI(4,5)P2 and decreases vinculin localization in focal adhesions in control U2OS cells but has no effect on U2OS cells overexpressing Myc-CHKB. (A) U2OS cells were transiently transfected with the PI(4,5)P2 reporter PH-PLCD1-GFP and were treated with the choline kinase alpha inhibitors EB-3D (10 mM), CK-37 (15 mM) or vehicle for 48 h and live cells were imaged by spinning-disk confocal microscopy. Choline kinase alpha inhibition resulted in the loss of dorsal membrane PH- PLCD1-GFP clusters in the U2OS cells. (B) The ratio of dorsal plasma membrane: cytoplasmic PH-PLCD1-GFP fluorescence is significantly decreased in choline kinase

Article Snippet: GFP-mouse vinculin full length (889) was a gift from Alpha Yap (plasmid #67935; Addgene; http://n2t.net/addgene:67935; RRID:Addgene_67935), mRFP-Lact-C2 was a gift from Sergio Grinstein (plasmid #74061; Addgene; http://n2t.net/addgene:74061; RRID:Addgene_74061) and was previously described (52).

Techniques: Control, Transfection, Confocal Microscopy, Inhibition, Membrane, Clinical Proteomics

Figure 5. Inhibition of choline kinase activity does not alter PS distribution with internalized PI(4,5)P2 associating with enriched PS structures in U2OS cells. (A, B) U2OS cells were transiently co- transfected with the PI(4,5)P2 reporter PH- PLCD1-GFP and PS reporter mRFP-Lact-C2 and were treated with DMSO (vehicle control) or the choline kinase alpha inhibitor EB-3D (15 mM) for 48 h and imaged by spinning-disk confocal microscopy in live cells. Choline kinase inhibition resulted in internalization of dorsal plasma membrane PH-PLCD1-GFP fluorescence where it colocalized PS containing organelles. Scale bar = 15 μm. (C) Quantification of the ratio of dorsal plasma membrane: cytoplasmic PS reporter mRFP- Lact-C2. (D, E) Quantification of the fraction of PI(4,5)P2 overlapping PS (D),and the fraction of PS overlapping PI(4,5)P2 (E) using the Manders’ colocalization coefficients in vehicle-treated and choline kinase inhibited cells. (F) Colocalization between PI(4,5)P2 and PS quantified as Pearson's correlation coefficient in vehicle-treated and choline kinase inhibited cells. For (C, D, E, F) data show the mean ± SD. N = 25 random cells per group. *P < 0.05, **P < 0.01, ***P < 0.001 (t test).

Journal: Life science alliance

Article Title: Defects in integrin complex formation promote CHKB -mediated muscular dystrophy.

doi: 10.26508/lsa.202301956

Figure Lengend Snippet: Figure 5. Inhibition of choline kinase activity does not alter PS distribution with internalized PI(4,5)P2 associating with enriched PS structures in U2OS cells. (A, B) U2OS cells were transiently co- transfected with the PI(4,5)P2 reporter PH- PLCD1-GFP and PS reporter mRFP-Lact-C2 and were treated with DMSO (vehicle control) or the choline kinase alpha inhibitor EB-3D (15 mM) for 48 h and imaged by spinning-disk confocal microscopy in live cells. Choline kinase inhibition resulted in internalization of dorsal plasma membrane PH-PLCD1-GFP fluorescence where it colocalized PS containing organelles. Scale bar = 15 μm. (C) Quantification of the ratio of dorsal plasma membrane: cytoplasmic PS reporter mRFP- Lact-C2. (D, E) Quantification of the fraction of PI(4,5)P2 overlapping PS (D),and the fraction of PS overlapping PI(4,5)P2 (E) using the Manders’ colocalization coefficients in vehicle-treated and choline kinase inhibited cells. (F) Colocalization between PI(4,5)P2 and PS quantified as Pearson's correlation coefficient in vehicle-treated and choline kinase inhibited cells. For (C, D, E, F) data show the mean ± SD. N = 25 random cells per group. *P < 0.05, **P < 0.01, ***P < 0.001 (t test).

Article Snippet: GFP-mouse vinculin full length (889) was a gift from Alpha Yap (plasmid #67935; Addgene; http://n2t.net/addgene:67935; RRID:Addgene_67935), mRFP-Lact-C2 was a gift from Sergio Grinstein (plasmid #74061; Addgene; http://n2t.net/addgene:74061; RRID:Addgene_74061) and was previously described (52).

Techniques: Inhibition, Activity Assay, Transfection, Control, Confocal Microscopy, Clinical Proteomics, Membrane

hsa_circ_0009035 in CC cells directly targeted miR-889-3p by binding to miR-889-3p. (A) Venn diagram of the putative miRNAs of hsa_circ_0009035 predicted by Circinteractome and Starbase softwares. (B and C) The expression levels of miR-1296, miR-182, miR-653, and miR-889-3p by qRT-PCR in sh-NC-infected or sh-hsa_circ_0009035-transduced HeLa and Siha cells. (D) RNA pulldown assays in HeLa cells using Bio-anti-hsa_circ_0009035 or Bio-NC. (E) Sequence of miR-889-3p and the putative miR-889-3p-binding sequence within hsa_circ_0009035. (F and G) Relative miR-889-3p expression determined by qRT-PCR in HeLa and Siha cells transfected with negative-control plasmid pCD5-ciR, an hsa_circ_0009035-overexpressing plasmid (hsa_circ_0009035), or a mutant hsa_circ_0009035-overexpressing plasmid (MUT-hsa_circ_0009035). (H) RIP assay in HeLa and Siha cells using IgG or AGO2 antibody. (I) RNA pulldown assays in HeLa cells using Bio-NC or Bio-miR-889-3p. (J and K) qRT-PCR analysis of hsa_circ_0009035 expression in cells transfected with miR-NC mimic, miR-889-3p mimic, anti-miR-889-3p, or anti-miR-NC. (L) The level of pre-miR-899 by qRT-PCR in cells transduced with sh-NC, sh-hsa_circ_0009035, or sh-hsa_circ_0009035#2. Relative miR-889-3p expression by qRT-PCR in 82 pairs of CC tissues and adjacent normal tissues (M) and CC tissues from 36 primary patients (defined as radiation-sensitive CC) and 46 recurrent patients after radiation treatment (defined as radiation-resistant CC) (N). (O) Correlation between miR-889-3p and hsa_circ_0009035 expression levels in CC tissues using the Spearman test. (P and Q) Copy numbers of hsa_circ_0009035 and miR-889-3p in HeLa and Siha cells and 5 case CC tissues. * , P < 0.05.

Journal: Molecular and Cellular Biology

Article Title: Silencing of hsa_circ_0009035 Suppresses Cervical Cancer Progression and Enhances Radiosensitivity through MicroRNA 889-3p-Dependent Regulation of HOXB7

doi: 10.1128/MCB.00631-20

Figure Lengend Snippet: hsa_circ_0009035 in CC cells directly targeted miR-889-3p by binding to miR-889-3p. (A) Venn diagram of the putative miRNAs of hsa_circ_0009035 predicted by Circinteractome and Starbase softwares. (B and C) The expression levels of miR-1296, miR-182, miR-653, and miR-889-3p by qRT-PCR in sh-NC-infected or sh-hsa_circ_0009035-transduced HeLa and Siha cells. (D) RNA pulldown assays in HeLa cells using Bio-anti-hsa_circ_0009035 or Bio-NC. (E) Sequence of miR-889-3p and the putative miR-889-3p-binding sequence within hsa_circ_0009035. (F and G) Relative miR-889-3p expression determined by qRT-PCR in HeLa and Siha cells transfected with negative-control plasmid pCD5-ciR, an hsa_circ_0009035-overexpressing plasmid (hsa_circ_0009035), or a mutant hsa_circ_0009035-overexpressing plasmid (MUT-hsa_circ_0009035). (H) RIP assay in HeLa and Siha cells using IgG or AGO2 antibody. (I) RNA pulldown assays in HeLa cells using Bio-NC or Bio-miR-889-3p. (J and K) qRT-PCR analysis of hsa_circ_0009035 expression in cells transfected with miR-NC mimic, miR-889-3p mimic, anti-miR-889-3p, or anti-miR-NC. (L) The level of pre-miR-899 by qRT-PCR in cells transduced with sh-NC, sh-hsa_circ_0009035, or sh-hsa_circ_0009035#2. Relative miR-889-3p expression by qRT-PCR in 82 pairs of CC tissues and adjacent normal tissues (M) and CC tissues from 36 primary patients (defined as radiation-sensitive CC) and 46 recurrent patients after radiation treatment (defined as radiation-resistant CC) (N). (O) Correlation between miR-889-3p and hsa_circ_0009035 expression levels in CC tissues using the Spearman test. (P and Q) Copy numbers of hsa_circ_0009035 and miR-889-3p in HeLa and Siha cells and 5 case CC tissues. * , P < 0.05.

Article Snippet: In RNA pulldown assays, cell lysates were incubated with a biotin-labeled miR-899-3p mimic (Bio-miR-889-3p; Ribobio), a biotinylated antisense oligomer ( CTTTAGTCT ) spanning the junction of hsa_circ_0009035 (Bio-anti-hsa_circ_0009035), or a negative control (Bio-NC; Ribobio) for 3 h at 4°C before addition of the streptavidin beads (Thermo Fisher Scientific) for 3 h. In both assays, total RNA was prepared from the beads for the assessment of hsa_circ_0009035, HOXB7, and miRNA levels.

Techniques: Binding Assay, Expressing, Quantitative RT-PCR, Infection, Sequencing, Transfection, Negative Control, Plasmid Preparation, Mutagenesis, Transduction

The effects of miR-889-3p overexpression on CC progression and radiosensitivity in vitro were mediated by HOXB7. (A) Relative HOXB7 protein level determined by Western blotting in cells transfected with a negative-control plasmid (pcDNA) or a HOXB7-overexpressing plasmid (HOXB7). HeLa and Siha cells were transfected with an miR-NC mimic, an miR-899-3p mimic, an miR-899-3p mimic plus pcDNA, or an miR-899-3p mimic plus HOXB7, followed by the determination of HOXB7 protein level by Western blotting (B), cell proliferation by CCK-8 assay (C and D), analysis of cell colony formation by colony formation assay (E), analysis of cell cycle progression and apoptosis by flow cytometry (F to H), analysis of cell migration and invasion by transwell assay (I to L), determination of cell survival fraction by colony formation upon radiation exposure (M and N), and measurement of the levels of PCNA, c-caspase 3, procaspase 3, and MMP3 by Western blotting (O and P). * , P < 0.05.

Journal: Molecular and Cellular Biology

Article Title: Silencing of hsa_circ_0009035 Suppresses Cervical Cancer Progression and Enhances Radiosensitivity through MicroRNA 889-3p-Dependent Regulation of HOXB7

doi: 10.1128/MCB.00631-20

Figure Lengend Snippet: The effects of miR-889-3p overexpression on CC progression and radiosensitivity in vitro were mediated by HOXB7. (A) Relative HOXB7 protein level determined by Western blotting in cells transfected with a negative-control plasmid (pcDNA) or a HOXB7-overexpressing plasmid (HOXB7). HeLa and Siha cells were transfected with an miR-NC mimic, an miR-899-3p mimic, an miR-899-3p mimic plus pcDNA, or an miR-899-3p mimic plus HOXB7, followed by the determination of HOXB7 protein level by Western blotting (B), cell proliferation by CCK-8 assay (C and D), analysis of cell colony formation by colony formation assay (E), analysis of cell cycle progression and apoptosis by flow cytometry (F to H), analysis of cell migration and invasion by transwell assay (I to L), determination of cell survival fraction by colony formation upon radiation exposure (M and N), and measurement of the levels of PCNA, c-caspase 3, procaspase 3, and MMP3 by Western blotting (O and P). * , P < 0.05.

Article Snippet: In RNA pulldown assays, cell lysates were incubated with a biotin-labeled miR-899-3p mimic (Bio-miR-889-3p; Ribobio), a biotinylated antisense oligomer ( CTTTAGTCT ) spanning the junction of hsa_circ_0009035 (Bio-anti-hsa_circ_0009035), or a negative control (Bio-NC; Ribobio) for 3 h at 4°C before addition of the streptavidin beads (Thermo Fisher Scientific) for 3 h. In both assays, total RNA was prepared from the beads for the assessment of hsa_circ_0009035, HOXB7, and miRNA levels.

Techniques: Over Expression, In Vitro, Western Blot, Transfection, Negative Control, Plasmid Preparation, CCK-8 Assay, Colony Assay, Flow Cytometry, Migration, Transwell Assay